mil 6 Search Results


97
ATCC yamagata b new hampshire 01 2016 100 eid50
Yamagata B New Hampshire 01 2016 100 Eid50, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/yamagata b new hampshire 01 2016 100 eid50/product/ATCC
Average 97 stars, based on 1 article reviews
yamagata b new hampshire 01 2016 100 eid50 - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

92
InvivoGen mouse antibodies
Mouse Antibodies, supplied by InvivoGen, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse antibodies/product/InvivoGen
Average 92 stars, based on 1 article reviews
mouse antibodies - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
Addgene inc 160 myd88 d3 pcmv flag cerutti lab flag
160 Myd88 D3 Pcmv Flag Cerutti Lab Flag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/160 myd88 d3 pcmv flag cerutti lab flag/product/Addgene inc
Average 90 stars, based on 1 article reviews
160 myd88 d3 pcmv flag cerutti lab flag - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

95
Bio X Cell anti mil6 receptor 15a7 antibodies
Anti Mil6 Receptor 15a7 Antibodies, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti mil6 receptor 15a7 antibodies/product/Bio X Cell
Average 95 stars, based on 1 article reviews
anti mil6 receptor 15a7 antibodies - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
Kinetic Imaging Ltd stereology software b-version
Stereology Software B Version, supplied by Kinetic Imaging Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stereology software b-version/product/Kinetic Imaging Ltd
Average 90 stars, based on 1 article reviews
stereology software b-version - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PeproTech cytokine cocktail (mil6, mil3 mscf
Cytokine Cocktail (Mil6, Mil3 Mscf, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cytokine cocktail (mil6, mil3 mscf/product/PeproTech
Average 90 stars, based on 1 article reviews
cytokine cocktail (mil6, mil3 mscf - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Becton Dickinson mil-6
Mil 6, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mil-6/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
mil-6 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen mil-6 primer
Mil 6 Primer, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mil-6 primer/product/Qiagen
Average 90 stars, based on 1 article reviews
mil-6 primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Becton Dickinson recombinant mil-12 protein
Recombinant Mil 12 Protein, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mil-12 protein/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
recombinant mil-12 protein - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
STEMCELL Technologies Inc mil-6
Mil 6, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mil-6/product/STEMCELL Technologies Inc
Average 90 stars, based on 1 article reviews
mil-6 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eurofins mil4.r

Mil4.R, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mil4.r/product/Eurofins
Average 90 stars, based on 1 article reviews
mil4.r - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Abnova mil-6

Mil 6, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mil-6/product/Abnova
Average 90 stars, based on 1 article reviews
mil-6 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Journal: iScience

Article Title: Enniatin A inhibits the chaperone Hsp90 and unleashes the immune system against triple-negative breast cancer

doi: 10.1016/j.isci.2023.108308

Figure Lengend Snippet:

Article Snippet: mIL4.R GCCGATGATCTCTCTCAAGTGAT , Eurofins , N/A.

Techniques: Affinity Purification, Purification, Recombinant, Proliferation Assay, Software